Разрушение хряща коленного сустава


Лекарство для восстановления хрящевой ткани суставов

Проблема восстановления хрящей актуальна для более чем 80% людей старше 65 лет, страдающих от деформирующего остеоартроза. Пока не изобретено универсальное средство, возобновляющее структуру хрящей и полностью излечивающее патологию. Однако есть препараты для восстановления хрящевой ткани суставов, обладающие хондропротекторным и регенерирующим действием.

Вид на поражённую хрящевую поверхность.

Ни один из существующих препаратов для восстановления суставов не в состоянии вылечить остеоартроз. Некоторые из них замедляют дегенеративные процессы, облегчают самочувствие больного, но не спасают от патологии.

Стадии артроза коленного сустава. Обратите внимание на сужение суставной щели.

Все медикаментозные средства эффективны лишь на I—II стадиях артроза, но бессильны на III и IV. Если в патологию вовлечены не только суставы, но и кости, никакой препарат не поможет. В этом случае избавиться от хронических болей в суставах, трудностей при ходьбе, ограниченной подвижности суставов и других неприятных симптомов можно только с помощью операции.

Хондропротекторы

Важно знать! Врачи в шоке: "Эффективное и доступное средство от боли в суставах существует..." Читать далее...

Популярные и широко используемые лекарства для восстановления хрящевой ткани суставов — это хондропротекторы. До недавних пор в научных кругах велись активные споры об эффективности этих препаратов в борьбе с остеоартрозом.

Хондропротекторы повышают устойчивость хрящей к воздействию повреждающих факторов, облегчают боли, снимают воспаление в суставах и даже повышают активность хондроцитов. Препараты эффективны в восстановлении хрящевой ткани суставов у лиц с начальными стадиями остеоартроза.

Рекомендуем к просмотру сугубо научный анализ источников исследований эффективности хондропротекторов от Бориса Цацулина:

Существуют три поколения хондропротекторов. К первому относятся препараты, изготовленные из натуральных компонентов (Алфлутоп, Хондроксид), ко второму – монопрепараты (Дона, Структум, Артрадол), к третьему – комбинированные средства (Терафлекс, Артра, Глюкозамин-Хондроитин Плюс, Кондронова). Наиболее эффективны лекарства III поколения.

Хондропротекторы выпускаются в виде мазей, таблеток, растворов для внутримышечного или внутрисуставного введения. Наружные формы применяются в основном для лечения артроза мелких суставов и спондилоартроза. Внутримышечные и внутрисуставные инъекции назначают редко, хотя инъекционное введение лекарств повышает их биодоступность.

Врачи рекомендуют пациентам таблетированные формы хондропротекторов. Лекарства принимают курсами по 2-3 месяца. В год достаточно проходить 3-4 курса терапии.

Таблица 1. Популярные хондропротекторы

Препарат Действующее вещество Описание и особенности применения
Алфлутоп Биоактивный концентрат из морской рыбы Препарат стимулирует восстановление хрящей, предотвращает разрушение здоровых тканей, оказывает противовоспалительное и обезболивающее действие. Наиболее эффективно сочетание внутрисуставных инъекций с внутримышечным введением Алфлутопа
Терафлекс Глюкозамин + Хондроитин Один из эффективных препаратов, восстанавливающих хрящевую ткань в суставах. Относится к III поколению хондропротекторов. Выпускается в виде капсул. Терафлекс следует пить курсами длительностью не менее 2 месяцев. Между курсами следует делать перерывы продолжительностью в 3 месяца
Дона Глюкозамина сульфат Хондропротектор II поколения. Содержит только один активный компонент, из-а чего уступает по эффективности более современным препаратам. Выпускается в форме капсул, порошка для приема внутрь и раствора для внутримышечного введения
Артра Хондроитин + Глюкозамин Эффективные таблетки для восстановления хрящевой ткани суставов. Принадлежат к хондропротекторам III поколения. Назначаются курсами, по 4-6 месяцев каждый
Структум Хондроитина сульфат Еще один монопрепарат II поколения. Структум выпускается в таблетках. Для лечения остеоартроза назначается курсами, как и все остальные хондропротекторы

Жидкие протезы синовиальной жидкости

Жидкие импланты — это препараты гиалуроновой кислоты для внутрисуставного введения. Они восстанавливают нормальный состав и вязкоупругие свойства синовиальной жидкости, улучшая трофику хрящей и замедляя их разрушение. Препараты гиалуроновой кислоты вводят непосредственно в полости суставов.

"Врачи скрывают правду!"

Даже "запущенные" проблемы с суставами можно вылечить дома! Просто не забывайте раз в день мазать этим...

>

Лекарства, содержащие гиалуроновую кислоту:

  • Синвиск;
  • Остенил;
  • Гиастат;
  • Ферматрон;
  • Гоу Он.

Жидкие протезы синовиальной жидкости обычно выпускаются в готовых шприцах. Лекарства необходимо всего лишь ввести в суставную полость. Процедуру имеет право проводить только врач. Манипуляцию выполняют в специально оборудованном для этого кабинете.

Препараты гиалуроновой кислоты показаны для восстановления суставов и хрящей на начальных стадиях артроза. Они помогают заметно облегчить боли, улучшить функциональное состояние суставов. Для получения хорошего эффекта инъекции нужно делать с частотой 2-3 раза в год.

Гидролизированный коллаген

Изначально питьевой коллаген принимали бодибилдеры для укрепления костей, связок и суставов. Позже ученые выяснили, что это вещество восстанавливает хрящевую ткань, облегчает боли при заболеваниях суставов. Коллаген укрепляет кости путем стимуляции остеобластов.

Сегодня в клинической практике используется препарат CH-Alpha, содержащий гидролизат питьевого коллагена FORTIGEL. Рекомендованная доза лекарства составляет 10 граммов в сутки. Средство принимают 1 раз в день во время еды. Курс лечения питьевым коллагеном в среднем составляет 2 месяца.

Чтобы добиться результатов, принимайте гидролизат коллагена вместе с комбинированными хондропротекторами, содержащими хондроитин и глюкозамин. Перед началом лечения обязательно посоветуйтесь с врачом.

Продукты клеточной инженерии

Ученые работают над созданием методик по полному восстановлению хрящевой ткани суставов. Но их попытки создать искусственный хрящ пока что не увенчались успехом. Однако в клинической практике уже применяются клеточно-инженерные продукты, эффективно восстанавливающие собственную хрящевую ткань человека.

Продукты клеточной инженерии эффективнее обычных препаратов для восстановления суставов. Их цена высока, а производство сопряжено с трудностями и рисками. К примеру, выращивание клеточных культур может осложниться микробной контаминацией. Введение зараженного продукта в сустав приведет к тяжелым осложнениям.

Видео от Бориса Цацулина о побочных эффектах хондропротекторов:

Препараты клеточной инженерии для восстановления хрящевой ткани:

  • Chondrolon;
  • DeNovo-NT;
  • Cartigel;
  • Chondro-Gide;
  • BioSeed-C.

Клеточно-инженерные конструкции изготавливают из аутологичных хондроцитов, взятых у самого пациента. Полученные клетки культивируют на питательных средах, добавляют к ним нужные компоненты и вводят в синовиальную полость. Такие препараты эффективно восстанавливают хрящевую ткань. Они малоэффективны на последних стадиях артроза, когда в патологию вовлечены кости.

В нашей стране пока что нет возможности изготавливать препараты клеточной инженерии. Такие технологии развиваются в США, Корее и некоторых странах Европы.

Похожие статьи

Как забыть о болях в суставах?

  • Боли в суставах ограничивают Ваши движения и полноценную жизнь…
  • Вас беспокоит дискомфорт, хруст и систематические боли…
  • Возможно, Вы перепробовали кучу лекарств, кремов и мазей…
  • Но судя по тому, что Вы читаете эти строки - не сильно они Вам помогли…

Но ортопед Валентин Дикуль утверждает, что действительно эффективное средство от боли в суставах существует! Читать далее >>>

загрузка...

Хирургическое лечение дефектов суставного хряща коленного сустава: мы выигрываем?

Повреждение суставного хряща (AC) - распространенное заболевание. Для восстановления или регенерации дефектов хряща с разной степенью успеха использовались многочисленные методы. Три часто применяемых метода включают стимуляцию костного мозга, восстановление хряща и регенерацию хряща. В этой статье основное внимание уделяется текущему уровню доказательств, уделяя особое внимание методам регенерации хряща.

1.Введение

Травма переменного тока - распространенное заболевание колена. От него страдают люди любого возраста и пола. С постоянно растущим населением и активным образом жизни старшего поколения, частота травм переменного тока растет. В США выполняется более 500 000 процедур по поводу повреждений хряща, и большинство из них представляют собой повторные процедуры, свидетельствующие о неэффективности хирургического лечения [1]. Сообщается, что частота дефектов хряща достигает 65% при рутинной артроскопии коленного сустава [2–5]; однако значение этих дефектов для симптоматики еще не ясно.Хантер сообщил о неспособности суставного хряща к регенерации в 1743 году [6]. Ранние хондральные поражения часто не обнаруживаются из-за недостаточного нервного питания, а отсутствие сосудов ограничивает восстановительный потенциал.

Целостность переменного тока важна по разным причинам. Во-первых, поражения хондры могут вызывать механические симптомы, такие как отек и боль. Во-вторых, прогрессирование остеоартрита ускоряется, как сообщают Mankin и Davis [7, 8]. Sahlstorm сообщил о рентгенологических доказательствах ОА у 100% пациентов с поражениями стадии II и III по Альбеку через 20 лет [9].И, в-третьих, сложность его структуры и функциональных свойств, таких как минимизация трения и увеличение площади контактной поверхности для уменьшения износа под нагрузкой, затрудняет ремонт этого материала.

AC работает не только для защиты подлежащей субхондральной кости, но также служит для минимизации трения и увеличения нагрузки на суставную поверхность. Таким образом, лечение потери переменного тока направлено на восстановление этих свойств. АК состоит из хондроцитов (5–10%), воды (65–80%), коллагена, больших отрицательно заряженных гидрофильных протеогликанов (аггрекан, гиалуронан) и более мелких гликопротеинов, таких как фибронектин и олигомерные белки хряща [10].Микроскопически, от поверхностного до глубокого, описаны четыре отдельные зоны AC [11]. Поверхностная зона состоит в основном из удлиненных хондроцитов. Коллагеновые волокна меньшего диаметра (в основном тип II) проходят в этом слое параллельно суставной поверхности. Переходная зона состоит из коллагеновых волокон большого диаметра. Глубокая зона имеет перпендикулярно расположенные волокна коллажей и высокое содержание протеогликана, и, наконец, есть зона кальцинированного хряща .Коллаген типа II является преобладающей формой (95%), но также встречаются типы VI, IX, X и XI (в основном в кальцинированном слое). По мере приближения хондроцитов к поверхностной зоне они становятся более плоскими и приобретают фибробластическую форму. Такое расположение клеток вместе с коллагеновой сетью в поверхностной зоне придает гиалиновому хрящу устойчивость к силам сдвига, тогда как в поверхностной зоне белковая смазка, выделяемая хондроцитами, снижает коэффициент трения.

Повреждение AC может быть хрящевым или костно-хрящевым, если затрагивает подлежащую кость.Повреждение AC может быть травматическим или дегенеративным. В его этиологию вовлечены различные метаболические факторы, такие как ожирение, злоупотребление алкоголем и диабет, а также механические факторы, такие как нестабильность, травма и смещение суставов. [12]. Чистые хрящевые травмы безболезненны и плохо восстанавливаются из-за отсутствия кровоснабжения. Костно-хрящевые травмы заживают фиброзным хрящом вторично по отношению к начальной воспалительной реакции. Хотя мезенхимные клетки продуцируют коллаген I и II типов, восстановление в основном имеет фиброзно-хрящевой характер.В нем отсутствует упорядоченная структурная организация нормального гиалинового хряща, что приводит к ранней деградации и фрагментации [13].

При лечении дефектов переменного тока применялись как неоперационные, так и оперативные методы. Основная цель любого метода лечения - уменьшить боль и восстановить функцию. Неоперационные методы лечения включают снижение веса, физиотерапию для укрепления мышц, добавление вязких веществ гиалуроновыми препаратами, инъекции стероидов и пероральный прием хондроитинсульфата [14–17].Оперативное лечение в общих чертах классифицируется по трем категориям, а именно: методы стимуляции костного мозга (BMS), методы, методы замещения хряща, методы и методы регенерации хряща, методы. Эта статья направлена ​​на обзор современных концепций лечения дефектов суставного хряща в коленном суставе с особым упором на методы регенерации хряща.

2. Методы стимуляции костного мозга (BMS)
2.1. Методы сверления / микротрещин / абразии

Методы BMS направлены на стимулирование миграции мезенхимальных стволовых клеток в субхондральную кость.Технику микротрещин впервые описал Стедман [18]. Научная основа этого метода заключается в привлечении мезенхимальных стволовых клеток с поверхности кровоточащей кости. Они секретируют фиброзный хрящ, который в основном состоит из коллагена I типа. Такая восстанавливающая ткань может быть способна заполнить дефект, но не имеет нормальных гистологических или биомеханических свойств гиалинового хряща. Следовательно, он имеет более низкую устойчивость к силам сжатия и сдвига и имеет тенденцию к ухудшению со временем [19].Более молодой возраст ассоциируется с лучшим результатом. В серии из 72 пациентов моложе 45 лет Steadman сообщил об улучшении результатов у 80% пациентов через 7 лет [19]. Kreutz et al. также показали лучшее рентгенологическое заполнение дефектов хряща с более высокими баллами по шкале Цинциннати и ICRS у пациентов моложе 40 лет [20]. Снижение клинического исхода через 18–36 месяцев также более выражено у лиц старшего возраста [20]. Сравнение техники BMS с методами восстановления или регенерации обсуждается далее в следующих разделах.

3. Методы замещения хряща
3.1. Перенос аутотрансплантата хондроцитов и мозаичная пластика

Для замены хряща описаны два метода: перенос аутотрансплантата хондроцитов (ОАТ) и мозаичная пластика. ОАТ применяется с 1990-х годов [21]. Костно-хрящевые пробки берут с ненесущей поверхности ипсилатерального сустава и помещают в подготовленное цилиндрическое отверстие в области дефекта хряща. Ограничивающий фактор размера при ОАТ привел к развитию мозаичной пластики, при которой удаляются множественные небольшие костно-хрящевые пробки.Из-за множественных имплантаций конусов зазоры между заглушками создают неровную поверхность сустава [22]. Микротрещины в промежутках и введение остеогенного белка (BMP-7) использовались с разными результатами [23].

В связи с техническими трудностями и болезненностью донорского участка мозаичной пластики, ее использование нечасто. Однако наблюдается тенденция использования одиночных костно-хрящевых трансплантатов при изолированных дефектах хряща [24]. В серии из более чем 900 костно-хрящевых трансплантатов колена в течение 15 лет Hangody et al.сообщили о хороших или очень хороших результатах у 92% пациентов с дефектами бедренной кости, 87% в большеберцовой кости и 74% в пателлофеморальных суставах [25]. Другие авторы также сообщают о 84–88% хороших или очень хороших результатах через 2–4 года наблюдения [26, 27]. По сравнению с имплантацией аутологичных хондроцитов (ACI), Bentley показал хорошие или отличные результаты у 88% пациентов с ACI по сравнению с 69% после мозаичной пластики [28]. С другой стороны, Horas et al. показали лучший клинический и гистологический исход при мозаичной пластике [29].

Осложнения костно-хрящевой трансплантации включают поражение донорского участка с риском пателлофеморального артрита 2,3% [25]. Описаны также неудовлетворительное заполнение дефекта хряща (особенно с трансплантатами> 8 мм в диаметре) и гипертрофия фиброзного хряща донорского участка [27, 30].

4. Методы регенерации хрящевой ткани
4.1. Имплантация аутологичных хондроцитов (ACI)

Наиболее широко применяемым методом регенерации хряща является имплантация аутологичных хондроцитов (ACI), впервые описанная Бриттбергом в 1994 году [31].С тех пор ACI приобрела широкую популярность. ACI включает забор нормального хряща из не несущей части ипсилатерального сустава. Затем хондроциты расширяются in vitro и впоследствии имплантируются в хондральный дефект. Основная цель ACI - имплантировать хондроциты в дефект хряща, чтобы образовался гиалиновый хрящ, который по структурной организации и функциональным характеристикам очень похож на нормальный AC. ACI идеально используется при дефектах AC мыщелков бедренной кости, поскольку результаты поражения надколенника и большеберцовой кости несовместимы.ACI предпочтителен у более молодых пациентов без сопутствующей нестабильности связок и разрывов мениска. Для достижения оптимального результата могут потребоваться дополнительные процедуры, включая менискэктомию или стабилизацию связок. Для максимальной пользы также соблюдается строгий режим послеоперационной реабилитации. Противопоказания к ACI включают в себя септический артрит и воспалительный артрит, например ревматоидный, в анамнезе.

5. Хирургическая техника

ACI - это двухэтапная процедура. Для оценки поражения выполняется первоначальная артроскопия.От 3 до 4 хондральных биопсий AC берут с ненесущих поверхностей сустава (межмыщелковая вырезка, периферические края мыщелков бедренной кости). Затем образец транспортируется в лабораторию, где хондроциты выделяются с помощью ферментативного процесса. Затем хондроциты культивируют в течение 3-4 недель, пока объем не увеличится в 30 раз для имплантации (примерно 12 миллионов хондроцитов). Обычно через 6 недель после первой операции проводится второй этап операции. В зависимости от локализации поражения выполняется медиальная или латеральная артротомия надколенника.Дефект обработан и обработан. Затем берется надкостничный лоскут из проксимального отдела большеберцовой кости (также можно использовать медиальный мыщелок бедренной кости). Затем лоскут прикрепляют к дефекту (его камбиевый слой обращен к кости) со всех сторон, кроме верхней. Затем культивированные хондроциты вводятся под лоскут, и, наконец, лоскут также прикрепляется сверху. Для герметизации краев лоскута можно использовать фибриновый клей.

Послеоперационная реабилитация включает ранний диапазон движений с защитной нагрузкой на коленный ортез.Полная нагрузка обычно достигается через 8 недель. Затем начинается легкая тренировка сопротивления и равновесия. Через 3–4 месяца начинают упражнения для набора силы, и большинство врачей разрешают своим пациентам возобновить легкую атлетику через 6 месяцев. Возвращение к полноценным контактным видам спорта обычно не рекомендуется раньше, чем через 12–18 месяцев после процедуры.

6. Действует ли ACI?

Успех регенерации хряща зависит от его клинических, рентгенологических и гистологических результатов.В ряде обсервационных исследований были получены клинические результаты от хороших до отличных при краткосрочном и среднесрочном наблюдении [31–33]. При сравнении ACI и OATS, Horas показал аналогичные результаты для обеих процедур; однако скорость восстановления была медленнее с ACI [29]. Bentley показал хорошие или отличные результаты у 89% пациентов после ACI по сравнению с 69% после мозаичной пластики [28]. Дозин, с другой стороны, наблюдал улучшение у 88% пациентов после мозаичной пластики по сравнению только с 68% в группе ACI [34].Сарис сравнил имплантацию хондроцитов с техникой микропереломов и обнаружил лучшую гистоморфометрию хряща через 12 месяцев после имплантации хондроцитов; однако различий в клинических исходах (оценка по шкале KIIS, травмы колена и остеоартрита) через 12–18 месяцев не наблюдалось [35]. В другом рандомизированном контролируемом исследовании (РКИ) Knutsen не обнаружил различий в клинических и радиологических исходах между ACI и техникой микропереломов [36]. Сравнивая классический ACI с использованием периостального лоскута с коллагеновыми мембранами нового поколения типа I / III, Gooding et al.не наблюдали разницы в функциональном исходе через два года [37]. Аналогичное РКИ по сравнению ACI с матрично-индуцированным ACI, проведенное Bartlett et al. также не обнаружили существенной разницы между двумя методами [38].

К недостаткам процедуры ACI можно отнести гипертрофию трансплантата, при которой может потребоваться хирургическая обработка раны (36% случаев). Он включает две хирургические процедуры и требует больших затрат на культивирование хондроцитов in vitro. Из-за технических проблем, связанных с процедурой ACI, а также из-за необходимости большего хирургического воздействия, потребность в более простом и эффективном методе инъекции хондроцитов в сустав давно ощущалась [38, 39].Это привело к эволюции классической ACI в процедуры 2-го и 3-го поколения. ACI 2-го поколения использовали культивированные хондроциты, но заменили надкостничный лоскут резорбируемым коллагеновым матриксом. В методике 3-го поколения хондроциты высевают на коллагеновую мембрану I / III типа, а затем подвешивают к месту дефекта с помощью фибринового клея. Среди различных коммерчески доступных мембран наиболее часто выполняемая процедура называется матрикс-индуцированной имплантацией аутологичных хондроцитов (MACI, Genzyme Biosurgery, Кембридж, Массачусетс, США).Преимущества MACI заключаются не только в сокращении времени операции [40] и времени наложения жгута, но и в клинических результатах, аналогичных традиционным ACI.

Принцип метода MACI заключается в культивировании хондроцитов на биосовместимом трехмерном каркасе (очищенный и бесклеточный свиной коллаген), который затем имплантируется в дефект хряща [41]. MACI по-прежнему требует забор хондроцитов из нативного сустава. Общая процедура аналогична ACI 1-го поколения, за исключением того, что вместо надкостничного лоскута используется трехмерный каркас из коллагена I / III типа.В каркас предварительно засевают хондроциты. Клетки, выращенные на хрящевом каркасе, способны синтезировать компоненты матрикса хондроцитов, такие как хондроитинсульфат и гликозаминогликаны, а также белок S-100 (цитоплазматический маркер хондроцитов) [42, 43]. Комплекс каркаса-хондроцита затем наносится непосредственно на дефект AC после санации раны и приклеивается фибриновым клеем. Иногда для надежной фиксации при больших открытых дефектах требуется наложение швов. Поскольку для извлечения надкостничного лоскута расширенное рассечение не требуется, эту процедуру можно выполнить с помощью миниартротомии или артроскопии.После нанесения фибринового клея прикладывают давление в течение нескольких минут для достижения максимального сцепления. Преимущество этого метода заключается в более короткой продолжительности и в том, что его можно выполнять одновременно с другими процедурами, такими как реконструкция ПКС, остеотомия большой берцовой кости и костная пластика [40].

В послеоперационном периоде сустав иммобилизован в разгибании. Через 10 дней начинается контролируемая программа реабилитации. Было показано, что непрерывное пассивное движение (CPM) стимулирует синтез гликозаминогликанов, коллагена II типа и хондроитинсульфата [44].Режим защищенной нагрузки обычно составляет от восьми до двенадцати недель. Пациенту не разрешается полностью заниматься спортом в течение примерно 18 месяцев. Ранняя ускоренная реабилитация (восемь недель) не показала отрицательного эффекта по сравнению с отсроченной реабилитацией (одиннадцать недель) при краткосрочном наблюдении (3 месяца) [45]. Недавно полученные данные показали лучший клинический результат при ускоренной реабилитации, включая раннюю нагрузку на вес и диапазон двигательных упражнений [46–48].

7.Превосходит ли MACI другие методы регенерации хряща?

MACI - это более новая методика, и данные о ее эффективности в лучшем случае скудны. В нескольких сериях случаев описана его эффективность и хорошие краткосрочные результаты; тем не менее, долгосрочное наблюдение отсутствует. Беренс, Эльберт, Вентура и Шнайдер и др. описали значительное улучшение показателей активности Тегнера Международного комитета по документации коленного сустава (IKDC) и показателей Лисхольма и Гиллквиста [46, 49–51]. Однако рандомизированные исследования Bartlett, Zeifang и Manfredini, сравнивающие результаты после MACI и стандартного ACI с использованием периостального лоскута, не показали превосходства техники MACI [38, 52, 53].Zeifang et al. не отметили различий в IKDC, показателях активности Тегнера и краткой форме-36 через 12 и 24 месяца, тогда как лучшая эффективность наблюдалась с техникой ACI по шкале Lysholm и Gillquist [52]. Bartlett et al. также не наблюдали разницы в результатах после двух процедур [38]. Сообщается, что гипертрофия трансплантата составляет почти 25% в MACI; однако это не было связано с худшим клиническим исходом [54]. На моделях овец были проведены новые экспериментальные исследования по замене суставных хондроцитов предварительно дифференцированными мезенхимальными стволовыми клетками.Первоначальные результаты показали хорошее гистологическое восстановление с меньшей деградацией через 1 год по сравнению с классическими суставными хондроцитами [55]. Это, если окажется успешным на людях, может заменить необходимость первичной процедуры сбора хондроцитов.

8. Заключение

В заключение, поиск идеальной техники восстановления хряща продолжается. Технологии ремонта нового поколения показали некоторые надежды, но долгосрочный результат все еще неизвестен. Генетическая модуляция мезенхимальных стволовых клеток и хондроцитов вирусными и невирусными векторами также показала потенциал, но требует дальнейшей оценки.Чтобы доказать реальную пользу от этих дорогостоящих вмешательств, требуются долгосрочные данные. Хотя MACI показал хорошие первые результаты, его долгосрочная эффективность неизвестна. Артропластика с микропереломами и абразивным истиранием дешевы и проста в выполнении, но не обеспечивает долговременного ремонта. ОАТ и мозаичная пластика чрезвычайно сложны с технической точки зрения и имеют разные результаты. Поэтому восстановление суставного хряща остается предметом интенсивных исследований, и идеальное лечение еще не определено.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

.

Облегчение разрушения хряща синаповой кислотой при экспериментальном остеоартрите

Синаповая кислота (SA) модулирует сигнальный путь ядерного фактора-эритроидного 2 фактора 2 (Nrf2) в хондроцитах. Чтобы проверить гипотезу о том, что СК защищает от развития остеоартрита (ОА), первичные хондроциты мыши обрабатывали in vitro СК и промоторной трансактивационной активностью гемоксигеназы 1 (НО-1), ядерной транслокацией Nrf2, и анализировали экспрессию белка HO-1.Чтобы проверить гипотезу in vivo , была использована модель дестабилизации медиального мениска (DMM) для индукции ОА в коленях мышей, и SA вводили перорально экспериментальной группе. Хондроциты собирали для дальнейшего анализа. Экспрессия HO-1 аналогичным образом повышалась в хрящах как экспериментальных мышей, так и человеческих хондроцитов из коленных суставов с остеоартритом. Было обнаружено, что SA усиливает трансактивационную активность промотора гемоксигеназы 1 (HO-1) и увеличивает экспрессию Nrf2 и HO-1 в первичных хондроцитах.Гистопатологические оценки показали, что повреждение, вызванное моделью DMM, было значительно ниже в группе лечения SA. Добавление ингибитора HO-1 к SA не показало дополнительных преимуществ по сравнению с одной SA с точки зрения деградации хряща или гистопатологических показателей. Экспрессия TNF- α , IL-1 β , IL-6, MMP-1, MMP-3, MMP-13, ADAMTS4 и ADAMTS5 была значительно снижена как in vitro , так и in vivo путем наличие SA. Экспрессия белков HO-1 и Nrf2 была значительно увеличена в коленном хряще мышей, получавших пероральную СК.Наши результаты предполагают, что следует продолжить изучение SA в качестве профилактического лечения OA.

1. Введение

Остеоартрит (ОА) - распространенное заболевание суставов, характеризующееся разрушением суставного хряща. Сообщается, что этим заболеванием страдают около 18% женщин и 10% мужчин в возрасте старше 60 лет [1]. Боль и скованность в суставах снижают качество жизни пациентов с ОА. Часто операция по замене сустава является лучшим вариантом лечения на поздних стадиях заболевания, когда нехирургические методы лечения перестают быть эффективными.Прогрессирующая деградация суставного хряща является признаком прогрессирования заболевания; таким образом, ингибирование деградации хряща замедляет или останавливает прогрессирование заболевания при ОА [2]. Выявлено множество потенциальных терапевтических целей.

Ядерный фактор (эритроидный 2) -подобный 2 (Nrf2) является одной из этих потенциальных мишеней для лечения. Чрезмерный окислительный стресс приводит к апоптозу хондроцитов в прогрессировании ОА [3, 4]. Nrf2 представляет собой фактор транскрипции, который регулирует экспрессию своего нижнего гена, контролируя элементы антиоксидантного ответа (ARE), расположенные в промоторных областях его генов-мишеней, включая антиоксидантный фермент гемоксигеназу 1 (HO-1).Nrf2 участвует в нескольких дегенеративных заболеваниях многих органов, и активация Nrf2 развивается в потенциальное средство лечения возрастных заболеваний [5-8]. Сообщалось, что нарушение Nrf2 увеличивает уязвимость возрастной ретинопатии, вакуолярной лейкоэнцефалопатии и кардиомиопатии. HO-1 - это белок, расположенный ниже по течению от Nrf2. Было показано, что повышающая регуляция HO-1 защищает от разрушения хряща в коленных суставах мышей как в моделях посттравматического, так и в первичном старении.

Ранее мы продемонстрировали, что истощение Nrf2 приводит к быстрому разрушению повреждения хряща на двух отдельных моделях остеоартрита [9]. Это привело нас к цели Nrf2 / HO1 для лечения ОА. Синаповая кислота (SA) - это встречающаяся в природе гидроксикоричная кислота, которую можно экстрагировать из растений, таких как семена черной горчицы. СК считается природным антиоксидантом [10–12]. Исследование in vivo показало, что пероральное введение СК увеличивает экспрессию Nrf2 и HO-1 в тканях почек, легких и толстой кишки у крыс [13, 14].Также было показано, что SA ингибирует индуцируемую IL-1 β продукцию индуцибельной синтазы оксида азота (iNOS), оксида азота (NO), простагландина E2 (PGE2) и циклооксигеназы (Cox) -2 в хондроцитах крысы [15 ]. Принимая во внимание антиоксидантные и потенциальные противовоспалительные эффекты СК, мы предположили, что СК может оказывать защитное действие на хрящ в животной модели остеоартрита за счет активации Nrf2 / HO-1 и подавления катаболических и провоспалительных генов.

2.Материалы и методы
2.1. Пациенты-люди

Все образцы хрящей человека были собраны в больнице Sir Run Run. Хрящ остеоартроза был получен от 6 пациентов (возраст 68,67 ± 4,85 года) с диагнозом ОА, перенесших тотальное эндопротезирование коленного сустава (ТКА), а хрящ в контрольной группе - у 6 пациентов (возраст 27,67 ± 8,72 года) с травмой коленного сустава без OA или RA. Это исследование было одобрено этическим комитетом больницы им. Сэра Ран Ран Ран, и доноры подписали документы об информированном согласии.

2.2. Экспериментальный ОА и лечение SA

Самцов мышей C57BL / 6N дикого типа (24,5 г ± 2,4 г) в возрасте 8–10 недель, приобретенных в лаборатории SLAC (Шанхай, Китай), использовали для оценки защитного действия СК на хрящ. in vivo . Мышей содержали в стандартных клетках для мышей (по 10 животных на клетку) в условиях, свободных от специфических патогенов (SPF), при цикле свет-темнота 12:12 ч при 25 ± 2 ° C со стандартным кормом для мышей (RM3; Special Dietary Systems). и вода без ограничений.Все процедуры проводились в соответствии с рекомендациями Комитета по уходу и использованию животных Нанкинского медицинского университета (IACUC). Мышей анестезировали внутрибрюшинно кетамином (90 мкг г / г веса тела) и ксилазином (25 мкг г / г веса тела), а их левые колени были подготовлены для операции DMM. Остеоартрит был вызван рассечением медиальной мениско-большеберцовой связки, которая прикрепляет медиальный мениск (MM) к плато большеберцовой кости, после рассечения жировой подушечки, когда правое колено подвергалось фиктивной хирургии, при которой связка визуализировалась, но не пересекалась.Смещение медиальной ММ происходит после операции, в результате которой сосредоточена нагрузка на меньшую площадь, что впоследствии приводит к развитию ОА. Мышам вводили SA (Sigma-Aldrich, Сент-Луис, Миссури, США, 10 мг / кг), суспендированную в 10% водном растворе Твина 80, через желудочный зонд через день (10 мг / кг) после операции. Контрольным мышам через желудочный зонд вводили равный объем носителя (10% раствор Твин 80) [16]. Протопорфирин IX (SnPP, ингибитор HO-1; Sigma-Aldrich, Carnforth, UK 6 мг / кг) вводили внутрибрюшинно дважды в день, начиная с 14 дня после операции [17, 18].Коленные суставы были собраны для гистологической оценки согласно шкале OARSI одним исследователем, который не имел информации о группах и лечении [9].

2.3. Культура клеток

Коллагеназу D использовали для переваривания суставного хряща, который был собран с коленей 5-дневных мышей C57BL / 6N, как описано ранее [19]. Хондроциты, выделенные из суставного хряща одного помета, высевали на 10-сантиметровую чашку с исходной плотностью 5 × 10 5 клеток на чашку. После достижения 80% слияния клетки отделяли и случайным образом высевали в 6-луночные планшеты (10 5 на лунку), культивировали в Ham's F-12 (DMEM / F12), который содержит 100 мкг мкг / мл стрептомицина, 100 МЕ. / мл пенициллина, 5% FBS и 2 мМ L-глутамина.В наших анализах использовался только первый пассаж PMC. Набор для подсчета клеток-8 (CCK-8; Beyotime, Nanjing, China) использовали для измерения жизнеспособности клеток. Затем хондроциты обрабатывали разными дозами СК в разные промежутки времени для дальнейшего исследования.

2.4. Количественная полимеразная цепная реакция в реальном времени (qRT-PCR) и вестерн-блоттинг.

Коленный хрящ, собранный у мышей, выделяли с использованием реагента TRIzol (Invitrogen) после гомогенизации для экстракции РНК. Вкратце, хрящ, который быстро замораживали в жидком азоте и хранили при -80 ° C до экстракции РНК, растирали пестиком и в ступке, охлажденной жидким азотом, с последующей экстракцией TRIzol.Каждая экспериментальная единица представляет собой пул из 1-2 отсеков хряща. При выполнении пулинга экспериментальная установка считалась одной. Чистоту и выход РНК определяли на спектрофотометре NanoDrop ND-1000 (Nanodrop Technologies, США). кДНК получали из зрелой мРНК с помощью PrimeScript RT Master Mix (Takara Bio, Otsu, Japan) в соответствии с предоставленным протоколом. Q-ПЦР выполняли с помощью системы ПЦР в реальном времени 7500 с использованием реагентов SYBR Premix Ex Taq. Относительное количественное определение было определено как метод 2-ΔΔCt.Количественную ПЦР проводили в трех экземплярах для каждого образца. Последовательности праймеров показаны в таблице 1. Белки, лизированные из хряща из первичных хондроцитов мыши, и хрящевую ткань коленного сустава определяли и нормализовали для вестерн-блоттинга, как описано ранее [19]. Для суставного хряща человека объединение не проводилось. Каждая экспериментальная единица для мышей представляет собой бассейн из 2 хрящевых отсеков. Ядерная экстракция проводилась в соответствии с инструкциями производителя набора для экстракции ядерных белков (Beyotime Biotech Inc., Нанкин, Китай). Анти-актин и анти-ламин B были получены от Cell Signaling Technology (Беверли, Массачусетс, США). Антитела против Nrf2 и HO-1 были предоставлены компанией Bioworld Technology (Нанкин, Китай). Денситометрию белковой полосы проводили для вестерн-блоттинга. Полосы были полуколичественны с помощью денситометрии с обратным сканированием изображений в Photoshop (версия 6.0; Adobe, Сан-Хосе, Калифорния).

β α-GCAGGAT ATTTG69GCAGGAT TNF- α MPATTAGTT GACCAGCGC GCAGTGAACCAGCTATTATT MMP-3

Гены Праймеры qRT-PCR

IL-1 β Вперед: ATGGCAGAAGTACCTAAGCTCG
Реверс: ACACAAATTGCATGGTGAAGTCAGTT
IL-6 Вперед: ACACACTGGTTCTGAGGGAC
IL-6 Задний ход: TACCACAAGGAT
Реверс: CCAAAGTAGACCTGCCCGGACTC
MMP-1 Вперед: GCCACAAAGTTGATGCAGTT
MMP-1
Нападающий: GCAGAAGC TCCATACCAGCA
ММР-13 Вперед: ATGCATTCAGCTATCCTGGCCA
ММР-13 Реверс: AAGATTGCATTTCTCGGAGCCTG
ADAMTS4 Вперед: ATGGCCTCAATCCATCCCAG
ADAMTS4 Обратный: AAGCAGGGTTGGAATCTTTGC
ADAMTS5 Вперед: GGAGCGAGGCCATTTACAAC
ADAMTS5 Обратный: CGTAGACAAGGTAGCCCACTTT
ACTB Вперед: TGACGGGGTCACCCACACTGTGCCCATCTA
ACTB Обратный: CTAGAAGCATTTGCGGTGGACGATGGAGGG
HO-1 Вперед: ACATCGACAGCCCCACCAAGTTCAA
HO-1 Реверс: CTGACGAAGTGACGCCATCTGTGAG

IL: интерлейкин; TNF: фактор некроза опухоли; ММП: матриксная металлопротеиназа; ADAMTS: дезинтегрин и металлопротеиназа с мотивом тромбоспондина; qRT-PCR: количественная полимеразная цепная реакция в реальном времени; ACTB: актин; HO: гемоксигеназа.

2.5. Люциферазные анализы

Для анализа транскрипционной активности HO-1 клетки HEK293, помещенные в 24-луночные планшеты, трансфицировали плазмидами с использованием липофектамина 2000. На следующий день клетки обрабатывали 3 нг / мл и 9 нг / мл SA для 12 ч. Относительную активность люциферазы измеряли с помощью системы анализа люциферазы (Promega, Мэдисон, Висконсин, США). Данные были получены путем удаления фоновой активности люциферазы, нормализованной к активности люциферазы Renilla.Все анализы независимо повторяли не менее трех раз.

2.6. Статистический анализ

Все данные были проанализированы с помощью программного обеспечения GraphPad Prism 6.0 и выражены как среднее значение ± стандартное отклонение. Данные, следующие за распределением Гаусса, были дополнительно проанализированы с помощью t-критерия Стьюдента, данные без распределения по Гауссу с помощью U-критерия Манна-Уитни. P <0,05 считали статистически значимым.

3. Результаты
3.1. Экспрессия HO-1 усиливается в хряще при остеоартрите

Хрящ, пораженный остеоартритом, был взят из коленных суставов пациентов с ОА и мышей, индуцированных рассечением медиальной мениско-тибиальной связки через 4 недели после операции.Контрольную группу составили пациенты с травмой коленного сустава без ОА или РА и мыши, перенесшие фиктивную операцию, при которой связка визуализировалась, но не пересекалась. Наш результат показал, что уровень экспрессии HO-1 в хрящевой ткани как у людей, так и у мышей с ОА был намного выше, чем в контрольной группе, в то время как не было значительных различий между группами по экспрессии Nrf2 (Рисунки 1 (а) - 1 (г)).

3.2. SA активирует сигнальный путь Nrf2 в первичных хондроцитах мыши

Для получения нетоксичных концентраций SA, используемых в дальнейших экспериментах, мы проанализировали цитотоксичность в первичных хондроцитах мыши.Жизнеспособность клеток не снижалась при увеличении концентрации СК до 12 мкг мкг / мл (рис. 2 (а)). При этих уровнях концентрации наши результаты показали, что SA способствует ядерной транслокации Nrf2 и усиливает трансактивационную активность промотора HO-1 (Fig. 2 (b) –2 (d)). Впоследствии мы обнаружили, что экспрессия белка HO-1, нижестоящего белка Nrf2, повышалась после обработки SA (рисунки 2 (e) и 2 (f)). Эти данные продемонстрировали, что сигнальный путь Nrf2 / HO-1 эффективно активируется SA в первичных хондроцитах.

3.3. SA ингибирует индуцированную IL-1 β экспрессию MMP и ADAMTS в первичных хондроцитах мыши

MMP и ADAMTS5 способствовали разрушению хряща во время остеоартрита. Чтобы проверить терапевтические эффекты СК на остеоартрит, мы исследовали экспрессию генов, связанных с ОА, в хондроцитах, предварительно обработанных ИЛ-1 β в течение 24 часов (рис. экспрессия MMP-1, MMP-3, MMP-13, ADAMTS4 и ADAMTS5 в первичных хондроцитах мыши дозозависимым образом.

3.4. SA защищает от разрушения хряща OA In vivo

. Чтобы определить, замедляет ли SA прогрессирование OA in vivo , мы вводили SA мышам перорально после хирургической индукции OA. Через восемь недель собирали гистологические срезы коленных суставов и окрашивали Safranin O / Fast Green. Мы использовали систему оценки OARSI для количественной оценки гистопатологических изменений деструкции хряща коленного сустава. Результат показал, что баллы для бедренных и большеберцовых костей в группе, получавшей SA, были намного ниже, чем в контрольной группе (p <0.05) (Рисунки 4 (a) и 4 (b)), что означает, что пероральное введение SA защищает от прогрессирующего повреждения хряща при остеоартрите. Напротив, совместное лечение SnPP и SA не улучшило деградацию хряща и не изменило значительно баллы у мышей OA.

3.5. SA снижает экспрессию OA-ассоциированной мРНК

Мы собрали хрящ коленного сустава у мышей и исследовали уровни некоторых OA-ассоциированных мРНК с помощью количественной полимеразной цепной реакции в реальном времени. Результаты показали, что экспрессия генов TNF- α , IL-1 β , IL-6, MMP-1, MMP-3, MMP-13, ADAMTS4 и ADAMTS5, которые все были усилены в хряще контрольной группы. , были значительно снижены в группе, получавшей SA.Напротив, экспрессия HO-1 была увеличена в группе, получавшей SA (Рисунки 5 (a) –5 (i)).

3,6. SA способствует экспрессии HO-1 и Nrf2 in vivo

Экспрессию HO-1 и Nrf2 в коленном хряще мышей тестировали с помощью вестерн-блоттинга, чтобы установить, была ли повышена регуляция Nrf2 / HO-1 в группе, обработанной SA, как это было в группе. vitro . Наши данные показали, что экспрессия белков HO-1 и Nrf2 была значительно увеличена в коленном хряще мышей после систематической пероральной доставки SA (Рисунки 6 (a) и 6 (b)), что указывает на то, что SA может частично защищать от OA у мышей активацией сигнального пути Nrf2.

4. Обсуждение

Было показано, что окислительный стресс играет основную роль в деградации хряща в прогрессировании ОА. Изменение уровней некоторых маркеров окислительного стресса у больных ОА. Altindag et al. обнаружили, что общее количество пероксида (TP) и гидропероксида липидов в сыворотке было значительно выше у пациентов с остеоартритом коленного сустава по сравнению с пациентами без остеоартрита [20]. Маниш и др. наблюдали, что уровни реакционноспособных веществ тиобарбитуровой кислоты (TBARS) увеличились, в то время как уровни аскорбиновой кислоты, восстановленного глутатиона (GSH), каталазы и глутатионпероксидазы (GPx) снизились в эритроцитах субъектов с остеоартритом [21].Эти результаты показали, что у пациентов с остеоартритом количество оксидантов увеличилось, а количество антиоксидантов снизилось, что указывает на связь между оксидативным стрессом и ОА. Интересно, что не все антиоксиданты ингибировали прогрессирование ОА. Было обнаружено, что активность супероксиддисмутазы (СОД), фермента, катализирующего диспропорционирование супероксида, значительно повышается у пациентов с ОА [21]. Fernandez et al. указали, что гемоксигеназа 1 (HO-1), которая катализирует монооксид углерода, ион железа и разложение гема до билирубина, присутствует в хрящах как у пациентов с остеоартритом, так и у пациентов, не страдающих остеоартритом [22].Наше исследование показало, что уровень HO-1 значительно увеличился как у пациентов с остеоартритом, так и у мышей с ОА, индуцированным DMM, по сравнению с контрольной группой. Повышение уровня HO-1 в хряще можно рассматривать как благоприятный адаптивный ответ на окислительный стресс в хондроцитах во время прогрессирования ОА. Фактически, повышенная экспрессия HO-1 наблюдалась также при воспалительном артрите. Кобаяши и др. сообщили, что экспрессия HO-1 была повышена в синовиальных тканях пациентов с РА [23]. Maicas et al.также продемонстрировали, что HO-1 высоко экспрессируется в тканях суставов мышей с индуцированным сывороткой K / BxN ревматоидным артритом [24].

Другие исследования сообщили о регуляции HO-1 в хрящах. Takada et al. обнаружили, что отсутствие Bach-1, негативного регулятора HO-1, увеличивает экспрессию HO-1, который защищает от разрушения хряща в коленных суставах мышей из моделей посттравматического и первичного старения [25]. Nrf2 (ядерный фактор (эритроидный 2) -подобный 2) - еще один регулятор экспрессии HO-1.Известно, что он контролирует экспрессию антиоксидантных белков, которые защищают от окислительного повреждения. Nrf2 обычно сохраняется в цитоплазме и перемещается к ядру в стрессовых условиях. Он связывается с элементами антиоксидантного ответа (ARE), расположенными в промоторе; один из его генов-мишеней - HO-1 [26]. Наше предыдущее исследование показало, что делеция Nrf2 у мышей приводит к тяжелому ОА. Ансари сообщил, что при использовании синаповой кислоты (SA) как Nrf2, так и HO-1 были активированы в ткани почек крыс с нефротоксичностью, вызванной цисплатином [16].Синапиновая кислота представляет собой биодоступное при пероральном введении фитохимическое вещество, адсорбируемое в тонкой кишке, которое повышает уровень антиоксидантов в тканях почек, легких и толстой кишки при введении крысам и мышам 10-20 мг / кг массы тела. Из этого следует, что антиоксидантное действие синаповой кислоты на артритный хрящ будет включено в ее системные эффекты [10]. Наши результаты показали, что SA вызывает транслокацию Nrf2 в ядро, что в конечном итоге увеличивает экспрессию HO-1 в первичных хондроцитах мыши. Затем мы подтвердили защитные эффекты SA на хрящ in vivo у мышей.В соответствии с результатами in vitro уровни Nrf2 / HO-1 в коленном хряще увеличивались после того, как мышей OA перорально вводили SA. Напротив, введение SnPP, ингибитора HO-1, немного снижает защитные эффекты SA на хрящ, предполагая, что SA может защищать от окислительного повреждения через Nrf2 / HO-1 в хряще.

Хотя ОА давно классифицируется как невоспалительная артропатия, появляется все больше и больше данных о том, что воспалительные цитокины, хемокины и другие медиаторы воспаления влияют на процесс остеоартрита на всех стадиях [27, 28].Исследования как на тканях человека, так и на моделях животных показали, что суставные хондроциты активируются при остеоартрите, что приводит к нарушению гомеостаза и аберрантной экспрессии катаболических и провоспалительных генов [29, 30]. Наше исследование показало, что повышенная экспрессия MMP-1, MMP-3, MMP-13, ADAMTS4 и ADAMTS5 в хрящах мышей OA заметно подавлялась SA. Эти катаболические ферменты разрушают аггрекан и коллаген II, которые являются двумя основными компонентами матрикса суставного хряща.В нашем исследовании генетический анализ также выявил повышенную экспрессию IL-1, IL-6 и TNF- α в хряще остеоартрита. in vivo подавлялась SA. Предыдущие исследования показали, что чрезмерная продукция этих воспалительных цитокинов при ОА может ингибировать синтез матрикса и способствовать процессу деградации хряща [31]. В исследовании Ansari et al. SA значительно подавляла ядерную транслокацию субъединицы p65 NF- κ B и ДНК-связывающую активность, индуцированную кадмием в тканях почек [32].Хуанг и др. продемонстрировали, что SA ингибирует индуцированную IL-1 β активацию сигнального пути MAPK [15]. НО-1, индуцибельная изоформа НО, расщепляет гем до монооксида углерода, биливердина и Fe2 +, в то время как монооксид углерода может подавлять синтез медиаторов воспаления, таких как провоспалительные цитокины, оксид азота и простагландины. Связанное с этим исследование показало, что сверхэкспрессия HO-1 подавляла экспрессию молекул адгезии и вызывала активацию интерлейкина-6 и ядерного фактора- κ B в культивируемых клетках гладких мышц трахеи человека.Нокаут HO-1 и мышей дикого типа использовали для доказательства того, что общая провоспалительная тенденция связана с дефицитом HO-1. Эти результаты показывают, что противовоспалительные и антикатаболические эффекты SA могут вносить вклад в защитную роль хряща, и эффект может осуществляться через HO-1.

Чрезмерный окислительный стресс и воспаление вовлечены в деградацию хряща при прогрессировании ОА. В нашем исследовании SA повышала регуляцию Nrf2 / HO-1 и снижала экспрессию катаболических и провоспалительных генов как in vitro , так и in vivo .Это продемонстрировало защитную роль хряща при ОА. Хотя результат нашего исследования показал, что SA, введенная перорально мышам при остеоартрите коленного сустава, помогла предотвратить дегенерацию хряща, мы не определили, является ли SA защитным средством при предартрите коленных суставов.

5. Заключение

Таким образом, насколько нам известно, наше исследование является первым, подтверждающим эффективность SA на животной модели ОА. SA активирует сигнальные пути Nrf2 / HO-1 и оказывает сильное противовоспалительное действие на суставной хрящ при ОА.Эти результаты предполагают, что SA может выступать в качестве потенциально эффективного средства профилактики остеоартрита.

Доступность данных

Данные, использованные для подтверждения результатов этого исследования, можно получить у соответствующего автора по запросу.

Этическое одобрение

Процедуры эксперимента были рассмотрены и одобрены этическим комитетом больницы сэра Ран Ран и проводились в соответствии с принципами Хельсинкской декларации.

Конфликт интересов

У всех авторов нет конфликта интересов.

Вклад авторов

Давэй Цай и Цзянь Цинь разработали дизайн исследования; Давэй Цай, Цзюнь Лю, Танбо Юань и Цзицзянь Вэй отвечали за экспериментальные работы; Давэй Цай, Томас В. Хафф и Цзянь Цинь отвечали за анализ и интерпретацию данных; Томас В. Хафф и Цзянь Цинь сделали критическую редакцию статьи.

Благодарности

Это исследование было поддержано Фондом естественных наук высших учебных заведений Цзянсу Китая (грант No.18KJB320009) и Нанкинский фонд развития науки и технологий (грант № 201605066).

.

Проблемы с коленом, боль и лечение

Каковы симптомы проблем с коленями?

Симптомы проблемы с коленом зависят от типа травмы или заболевания.

Артрит

Наиболее распространенный тип артрита колена - остеоартрит. При этом заболевании хрящ в колене постепенно изнашивается. Симптомы остеоартроза колена:

Ревматоидный артрит и подагра - это другие типы артрита, поражающие колено.При ревматоидном артрите колено воспаляется, и хрящ может разрушаться. Симптомы ревматоидного артрита и подагры колена могут включать:

  • Боль.
  • Жесткость.
  • Отек.
  • Покраснение.
  • Горячий на ощупь.

Повреждения и болезни хряща

Хондромаляция

Хондромаляция возникает, когда хрящ коленной чашечки размягчается. Это может быть вызвано:

  • Травма.
  • Чрезмерное использование.
  • Слабость мышц.
  • Проблемы с выравниванием колен.
  • Травма коленной чашечки, в результате которой оторван кусок хряща или кусок хряща, содержащий фрагмент кости.

Наиболее частый симптом хондромаляции - тупая боль вокруг или под коленной чашечкой, которая усиливается при спуске по лестнице или с холма. Человек также может чувствовать боль при подъеме по лестнице или когда колено принимает на себя нагрузку при выпрямлении.

Заболевание часто встречается у бегунов, а также у лыжников, велосипедистов и футболистов.

Травма мениска

Мениск представляет собой С-образный кусок хряща, который действует как прокладка между бедренной или бедренной костью и большеберцовой или большеберцовой костью. Вы можете легко поранить его, когда колено перекручено при нагрузке. У вас может быть частичный или полный разрыв. Если разрыв крошечный, мениск остается соединенным с передней и задней частью колена. Если разрыв большой, мениск может висеть на хрящевой нити. Серьезность травмы зависит от места и размера разрыва.

Симптомы травм мениска включают:

  • Боль, особенно когда колено выпрямлено.
  • Отек.
  • Звук щелчка в колене.
  • Блокировка коленного сустава.
  • Слабость.

Иногда, если вы повредили колено, но не обратились за медицинской помощью, у вас могут развиться симптомы спустя месяцы или годы. Хотя симптомы повреждения мениска могут исчезнуть сами по себе, они часто сохраняются или возвращаются и требуют лечения.

Травмы связок

Две наиболее часто травмируемые связки колена:

  • Передняя крестообразная связка (ACL).
  • Задняя крестообразная связка (PCL).

Повреждение этих связок иногда называют «растяжением». ПКС чаще всего растягивается или разрывается (или и то, и другое) в результате резкого скручивающего движения. PCL обычно травмируется при прямом ударе, например, в автомобильной аварии или при захвате футбольного мяча. Симптомы могут включать:

  • Слышен хлопающий звук.
  • Сгибание ноги при попытке на нее встать.

Медиальная и латеральная коллатеральные связки обычно повреждаются при ударе по внешней стороне колена. Это может привести к растяжению и разрыву связки. Эти удары часто случаются в таких видах спорта, как футбол или хоккей. Симптомы могут включать:

  • Ощущение хлопка, при котором колено может искривиться.
  • Боль.
  • Отек.

Повреждения и поражения сухожилий

Существует три основных типа повреждений и повреждений сухожилий.

Тендинит и разрыв сухожилий

Травмы сухожилий варьируются от тендинита (воспаление сухожилия) до разрыва (разрыва) сухожилия. Рваные сухожилия чаще всего возникают от:

  • Чрезмерное использование сухожилия (особенно в некоторых видах спорта). Сухожилие растягивается, как изношенная резинка, и воспаляется.
  • Пытаюсь остановить падение. Если мышцы бедра сокращаются, может порваться сухожилие. Чаще всего это происходит у пожилых людей со слабыми сухожилиями.

Один из видов тендинита колена называется колено прыгуна.В спорте, требующем прыжков, например, в баскетболе, сухожилие может воспалиться или порваться.

Симптомы тендинита включают:

  • Боль и нежность на ощупь.
  • Боль при беге, спешке, ходьбе или прыжках.

Симптомы разрыва сухожилий включают:

  • Боль.
  • Трудно сгибать или разгибать ногу.
  • Трудно поднять ногу против силы тяжести.
Болезнь Осгуда-Шлаттера

Болезнь Осгуда-Шлаттера вызывается напряжением или растяжением части зоны роста верхней голени.Это может произойти, если ваше сухожилие оторвется от кости, унося с собой кусок кости. Такие травмы могут быть у молодых людей, которые бегают и прыгают во время занятий спортом. Симптомы обычно:

  • Боль ниже колена, которая обычно усиливается при физической активности и проходит в покое.
  • Костяная шишка под коленной чашечкой, болезненная при нажатии.
Синдром подвздошно-большеберцового бандажа

Синдром Iliotibial band возникает, когда сухожилие трется о внешнюю кость колена, вызывая отек.Это случается, если вы длительное время злоупотребляете коленом. Иногда это происходит во время спортивных тренировок. Симптомы могут включать:

  • Боль в стороне от колена, которая может распространяться по стороне бедра.
  • Ощущение щелчка при сгибании и выпрямлении ноги.
  • Боль или жжение сбоку в колене во время активности.

Другие травмы или заболевания коленного сустава

Рассекающий остеохондрит

Рассекающий остеохондрит возникает, когда к части кости под поверхностью сустава поступает недостаточное количество крови.Кость и хрящ постепенно разрыхляются, и некоторые хрящи могут отломиться. У человека с этим заболеванием может развиться остеоартрит. Симптомы могут включать:

  • Боль, которая может быть острой при отрыве хряща.
  • Слабость.
  • Фиксатор коленного сустава.
Площадь

Синдром Plica возникает, когда полосы ткани в колене, называемые складками, набухают в результате чрезмерного использования или травмы. Симптомы могут включать:

  • Боль.
  • Отек.
  • Ощущение щелчка в коленях
  • Слабость
  • Блокировка коленного сустава.
.

Однокомпонентная артропластика коленного сустава | UW Orthopaedics and Sports Medicine, Сиэтл

Обзор

В этой статье рассматриваются темы, связанные с однокомпонентной артропластикой коленного сустава (иногда называемой однокамерной заменой коленного сустава или частичной заменой коленного сустава) с использованием методов малоинвазивной хирургии (MIS) для лечения артрита.

Замена коленного сустава - это хирургическая процедура, которая уменьшает боль и улучшает качество жизни многих пациентов с тяжелым артритом колен.Обычно пациенты проходят эту операцию после того, как неоперативное лечение (например, инъекции лекарств для изменения активности в колено или ходьба с тростью) не помогло облегчить симптомы артрита. Хирурги выполняли замену коленного сустава более трех десятилетий, как правило, с отличными результатами; в большинстве отчетов показатель успешности за десять лет превышает 90 процентов.

Вообще говоря, существует два типа замены коленного сустава: полная замена коленного сустава (см. Рисунки 1 и 2) и однокамерная (или частичная) замена коленного сустава (см. Рисунки 3 и 4).Оба имеют длительный «послужной список» и хорошие клинические результаты в этой стране и в Европе.

Традиционная полная замена коленного сустава включает в себя разрез над коленом размером 7-8 дюймов, пребывание в больнице продолжительностью 3-5 дней и период восстановления (в течение которого пациент ходит с ходунками или тростью) продолжительностью от одного до трех месяцев. Подавляющее большинство пациентов сообщают о существенном или полном облегчении симптомов артрита после того, как они выздоровели после полной замены коленного сустава.

Частичные (однокамерные) замены коленного сустава существуют уже несколько десятилетий и предлагают отличные клинические результаты, как и полные замены коленного сустава.

Но за последние год или два хирурги и пациенты с большим энтузиазмом восприняли новый захватывающий подход к этой хорошо зарекомендовавшей себя процедуре. «Минимально-инвазивная» частичная замена коленного сустава (или «мини-колено») - это хирургическая техника, которая позволяет вставить частичную замену колена через небольшой (3–3,5 дюйма) разрез (см. Рис. 5) с минимальным повреждением мышц и сухожилия вокруг колена.

Небольшой размер разреза и менее инвазивный характер хирургического доступа позволяют пациентам восстанавливаться после операции «мини-колено» намного быстрее.Пребывание в больнице короче - до 1 или 2 дней для большинства пациентов - а период выздоровления на намного быстрее. Пациенты теряют меньше крови, испытывают значительно меньшую боль, чем при традиционной замене коленного сустава, и часто ходят без посторонней помощи (без трости или ходунков) в течение одной или двух недель после операции (см. Фильм 1). Даже многие пациенты, которым с помощью этой новой техники были обработаны одновременно оба колена, могут довольно быстро ходить без помощи ходунков или трости.

Пациент, идущий менее 2 недель после замены обоих колен в тот же день

Нажмите, чтобы увеличить
Рисунок 1 - Рентгеновский снимок традиционного тотального эндопротезирования коленного сустава.Эта операция выполняется пациентам с артритом коленного сустава. У большинства пациентов достигаются отличные отдаленные результаты. Нажмите, чтобы увеличить
Рисунок 2 - Модель традиционной тотальной замены коленного сустава. Коленная чашечка (коленная чашечка) в этой модели не показана. Нажмите, чтобы увеличить
Рисунок 3 - Рентгеновский снимок частичного или однокамерного протезирования коленного сустава. Эта операция проводится пациентам, у которых артрит ограничен одной стороной колена. Это можно сделать через очень маленький разрез, и восстановление после этой процедуры обычно происходит намного быстрее, чем при традиционной полной замене коленного сустава. Нажмите, чтобы увеличить
Рисунок 4 - Модель частичного эндопротезирования коленного сустава. Этот меньший имплант оставляет неповрежденный хрящ в других частях колена. Нажмите, чтобы увеличить
Рисунок 5 - На этой клинической фотографии показан типичный разрез, используемый для минимально инвазивной частичной замены коленного сустава. Средняя длина разреза, используемого в этой процедуре, составляет 3 дюйма. Меньшие разрезы способствуют более быстрому восстановлению и уменьшают послеоперационную боль по сравнению с традиционными операциями по замене коленного сустава.

Симптомы и диагностика

Характеристика артрита коленного сустава

Боль

Боль - самый заметный симптом артрита коленного сустава. У большинства пациентов боль постепенно усиливается с течением времени, но иногда имеет более внезапные «вспышки», когда симптомы становятся очень серьезными. Боль почти всегда усиливается от нагрузки и физической активности. У некоторых пациентов боль становится достаточно сильной, чтобы ограничить даже рутинную повседневную деятельность.

Жесткость

Утренняя скованность присутствует при некоторых типах артрита; пациенты с этим симптомом могут заметить некоторое улучшение гибкости колена в течение дня. Пациенты с ревматоидным артритом могут испытывать утреннюю скованность чаще, чем пациенты с остеоартритом.

Отек и тепло

Пациенты с артритом иногда замечают эти симптомы. Если отек и тепло чрезмерны и связаны с сильной болью, неспособностью сгибать колено и трудностями при переносе веса, эти признаки могут указывать на инфекцию.Такие серьезные симптомы требуют немедленной медицинской помощи. Совместная инфекция колена обсуждается ниже.

Расположение

В коленном суставе есть три «отсека», которые могут быть поражены артритом (см. Рисунок 6). У большинства пациентов наблюдаются как симптомы, так и результаты рентгенологического исследования, которые предполагают поражение двух или более из этих отделов - например, боль на боковой стороне (см. Рис. 7) и под коленной чашечкой (см. Рис. 8). Пациентам, у которых есть артрит в двух или всех трех отделах и которые решают чаще делать операцию, будет выполнено полное протезирование коленного сустава (см. Рисунки 9 и 10).

Однако у некоторых пациентов артрит ограничен одним отделом колена - чаще всего медиальной стороной (см. Рисунок 11). Когда пациенты с однокамерным артритом (также называемым «однокамерным» артритом) решают сделать операцию, они могут быть кандидатами на мини-колено (см. Рис. 12).

Типы

Воспалительный артрит

Эта обширная категория включает широкий спектр диагнозов, включая ревматоидный артрит, волчанку, подагру и многие другие.Важно, чтобы пациенты с этими состояниями находились под наблюдением квалифицированного ревматолога, поскольку существует ряд интересных новых методов лечения, которые могут уменьшить симптомы и, возможно, даже замедлить прогрессирование поражения суставов.

Пациенты с воспалительным артритом коленного сустава обычно имеют повреждение суставов во всех трех отделах и поэтому не являются хорошими кандидатами для частичной замены коленного сустава. Однако пациенты с воспалительным артритом, которые решают сделать полную замену коленного сустава, имеют чрезвычайно высокую вероятность успеха; эти пациенты часто испытывают полное или почти полное облегчение боли после хорошо выполненной замены сустава.

Остеоартроз

Остеоартрит также называют остеоартрозом или «дегенеративным заболеванием суставов». Пациенты с ОА составляют подавляющее большинство людей, страдающих артритом. ОА может поражать несколько суставов или локализоваться в пораженном колене. Ограничение активности из-за боли является признаком этого заболевания.

пациентов с ОА, симптомы которых ограничиваются одним отделом коленного сустава, иногда являются хорошими кандидатами на лечение мини-колена.

Подобные условия

Разрыв мениска

Иногда пациенты с болью в коленях вообще не болеют артритом.Каждое колено имеет два хрящевых кольца, называемых «менисками» (это множественное число от слова «мениск»). Мениски работают так же, как амортизаторы в автомобиле.

Мениски могут быть сильно разорваны при падении или в результате другой травмы, или у них могут образоваться дегенеративные разрывы в результате многолетнего износа. Пациенты с разрывами мениска испытывают боль внутри или снаружи колена; иногда боль усиливается при глубоком приседании или скручивании. Выталкивание и блокирование колена также являются случайными симптомами разрыва мениска.

Поскольку некоторые из этих симптомов могут присутствовать при артрите, а лечение артрита отличается от лечения разрыва мениска, важно поставить правильный диагноз. Хороший хирург-ортопед может различить эти два состояния, собрав подробный анамнез, проведя тщательный физический осмотр и получив результаты визуализационных тестов. Рентген и сканирование с помощью магнитно-резонансной томографии (МРТ) могут помочь в различении этих двух состояний.

Инфекции суставов

Также называемый инфекционным артритом или септическим артритом, инфекция суставов является серьезной проблемой, требующей неотложной медицинской (и часто хирургической) помощи.Если своевременно не лечить инфекцию коленного сустава, это может вызвать быстрое разрушение сустава; в худшем случае они могут стать опасными для жизни.

Нажмите, чтобы увеличить
Рисунок 6 - Артрит коленного сустава может поражать любой из трех отделов колена. Боль в колене с медиальной стороны, расположенная в той части колена, которая обращена к противоположному колену, является наиболее частым местом возникновения артритной боли. Нажмите, чтобы увеличить
Рисунок 7 - Боковая боль в колене, затрагивающая «внешнюю» часть колена, иногда является результатом артрита колена. Нажмите, чтобы увеличить
Рисунок 8 - Боль за коленной чашечкой при артрите может возникать вместе с артритом в другом месте колена или изолированно. Изолированный пателлофеморальный артрит является наименее распространенной формой артрита коленного сустава. .

Смотрите также